ID: 965693850_965693854

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 965693850 965693854
Species Human (GRCh38) Human (GRCh38)
Location 3:171386024-171386046 3:171386044-171386066
Sequence CCCACTCAGCTATGCTCCTGCTC CTCCTTCCAAAGCTGAAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 246} {0: 1, 1: 0, 2: 2, 3: 18, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!