ID: 965700798_965700805

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 965700798 965700805
Species Human (GRCh38) Human (GRCh38)
Location 3:171458226-171458248 3:171458279-171458301
Sequence CCGGCAGCAACTCCCAGCGTAGA AAAGCAGGAAGCCACAGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84} {0: 1, 1: 0, 2: 4, 3: 41, 4: 443}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!