ID: 965713189_965713201

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 965713189 965713201
Species Human (GRCh38) Human (GRCh38)
Location 3:171577388-171577410 3:171577419-171577441
Sequence CCCCTCAACCCCTTCTCTTTCAC GCAAGTCCTGCTTTTCTAGGGGG
Strand - +
Off-target summary No data {0: 18, 1: 82, 2: 166, 3: 110, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!