ID: 965722581_965722584

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 965722581 965722584
Species Human (GRCh38) Human (GRCh38)
Location 3:171677964-171677986 3:171678003-171678025
Sequence CCACCTACCAGATCACTGGAAGA CTGTGAATAAAGAACTCACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 160} {0: 1, 1: 0, 2: 1, 3: 13, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!