ID: 965768058_965768064

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 965768058 965768064
Species Human (GRCh38) Human (GRCh38)
Location 3:172152553-172152575 3:172152601-172152623
Sequence CCACTCACATTCTCCATGGGAAG ACCTGGTATTTTTGGAGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 265} {0: 1, 1: 0, 2: 4, 3: 31, 4: 466}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!