ID: 965768634_965768636

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 965768634 965768636
Species Human (GRCh38) Human (GRCh38)
Location 3:172157588-172157610 3:172157624-172157646
Sequence CCATCTGTTCTCCATCTCTAAAT TCATGTAAATGAAATCTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 472} {0: 1, 1: 2, 2: 16, 3: 98, 4: 471}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!