|
Left Crispr |
Right Crispr |
| Crispr ID |
965774001 |
965774009 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:172209683-172209705
|
3:172209707-172209729
|
| Sequence |
CCATAGGCTTCAGGCCCTCCCTG |
CTTAAAGGTGGAGTTTCACCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 23, 2: 171, 3: 319, 4: 552} |
{0: 1, 1: 17, 2: 110, 3: 368, 4: 752} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|