|
Left Crispr |
Right Crispr |
| Crispr ID |
965774086 |
965774096 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:172210030-172210052
|
3:172210079-172210101
|
| Sequence |
CCAGGGAGTGGAAGCAGGCACTT |
CTGGGTCCAGAGCTGCAGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 27, 2: 135, 3: 223, 4: 568} |
{0: 2, 1: 11, 2: 26, 3: 110, 4: 616} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|