ID: 965774091_965774096

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 965774091 965774096
Species Human (GRCh38) Human (GRCh38)
Location 3:172210058-172210080 3:172210079-172210101
Sequence CCTGCGGGAGCGCAGGGATGCCT CTGGGTCCAGAGCTGCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 288} {0: 2, 1: 11, 2: 26, 3: 110, 4: 616}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!