ID: 965779081_965779086

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 965779081 965779086
Species Human (GRCh38) Human (GRCh38)
Location 3:172264837-172264859 3:172264873-172264895
Sequence CCAAGGAAAAGGAAGCATTTCAG CCTTCTTTAATAAGGGTGCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 69, 4: 517} {0: 1, 1: 0, 2: 0, 3: 17, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!