ID: 965789536_965789538

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 965789536 965789538
Species Human (GRCh38) Human (GRCh38)
Location 3:172372844-172372866 3:172372890-172372912
Sequence CCAACATAAATATTGCATTGACT TGCTGTGCCCATTTTACAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 13, 4: 215} {0: 2, 1: 1, 2: 23, 3: 117, 4: 779}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!