ID: 965791089_965791093

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 965791089 965791093
Species Human (GRCh38) Human (GRCh38)
Location 3:172388607-172388629 3:172388625-172388647
Sequence CCTGGGGGAGGCACAGCTGTATG GTATGGCAGGCCTGGCGACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 211} {0: 1, 1: 0, 2: 1, 3: 14, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!