ID: 965810984_965811000

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 965810984 965811000
Species Human (GRCh38) Human (GRCh38)
Location 3:172591848-172591870 3:172591896-172591918
Sequence CCAAGATGGGTGATCTGTACTGT TGACAAGCAGCAGGGGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 78} {0: 1, 1: 0, 2: 5, 3: 85, 4: 465}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!