ID: 965821667_965821671

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 965821667 965821671
Species Human (GRCh38) Human (GRCh38)
Location 3:172690191-172690213 3:172690232-172690254
Sequence CCGCACCCAGCCAAGCATTTTTT AGAATACAGAGTATGAACGCAGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 106, 3: 792, 4: 5850} {0: 1, 1: 0, 2: 0, 3: 3, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!