ID: 965844382_965844395

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 965844382 965844395
Species Human (GRCh38) Human (GRCh38)
Location 3:172945533-172945555 3:172945580-172945602
Sequence CCCCTTCCCCATTCCCTGGCAGT AGGGAGAATACAGTAATTGTGGG
Strand - +
Off-target summary {0: 3, 1: 2, 2: 26, 3: 156, 4: 891} {0: 1, 1: 2, 2: 16, 3: 121, 4: 387}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!