ID: 965845034_965845041

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 965845034 965845041
Species Human (GRCh38) Human (GRCh38)
Location 3:172951634-172951656 3:172951678-172951700
Sequence CCTGGAGGACCTCCATTGTGAAT CACCTCTGCCAGCTTGTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 99} {0: 1, 1: 1, 2: 4, 3: 52, 4: 408}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!