ID: 965850537_965850541

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 965850537 965850541
Species Human (GRCh38) Human (GRCh38)
Location 3:173017504-173017526 3:173017531-173017553
Sequence CCAATGGTATGCTGGTAACCTGG CCTAAAAGTAAAAAAAAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 86} {0: 1, 1: 0, 2: 14, 3: 250, 4: 2052}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!