|
Left Crispr |
Right Crispr |
| Crispr ID |
965854446 |
965854453 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:173071384-173071406
|
3:173071436-173071458
|
| Sequence |
CCAGGACATTAGTCTGGACAAAG |
CCAAAGGAAAAATGGGCAAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 45, 2: 234, 3: 671, 4: 1152} |
{0: 1, 1: 46, 2: 597, 3: 1298, 4: 4568} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|