ID: 965872467_965872478

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 965872467 965872478
Species Human (GRCh38) Human (GRCh38)
Location 3:173278402-173278424 3:173278448-173278470
Sequence CCTCACTCTCCCAGACCTCACCA AAATGGCATGGAGTTGCACTAGG
Strand - +
Off-target summary {0: 14, 1: 10, 2: 9, 3: 60, 4: 499} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!