ID: 965905360_965905365

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 965905360 965905365
Species Human (GRCh38) Human (GRCh38)
Location 3:173699007-173699029 3:173699045-173699067
Sequence CCACCTTGCCCAGCTAATTTTGT GCGTTATCTCCAGGTTGTTCAGG
Strand - +
Off-target summary {0: 35, 1: 3309, 2: 23213, 3: 86507, 4: 159922} {0: 1, 1: 0, 2: 0, 3: 15, 4: 789}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!