ID: 965973721_965973724

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 965973721 965973724
Species Human (GRCh38) Human (GRCh38)
Location 3:174595121-174595143 3:174595162-174595184
Sequence CCCATATTCAGTCACTAAATGCA CACATTCAGGTCTCATGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 202} {0: 1, 1: 0, 2: 2, 3: 20, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!