ID: 965984120_965984127

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 965984120 965984127
Species Human (GRCh38) Human (GRCh38)
Location 3:174731079-174731101 3:174731128-174731150
Sequence CCCGCACACTATCATGGAAAGTG AACATTTATGACTTTGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 109} {0: 1, 1: 0, 2: 1, 3: 46, 4: 392}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!