ID: 966001083_966001088

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 966001083 966001088
Species Human (GRCh38) Human (GRCh38)
Location 3:174949231-174949253 3:174949251-174949273
Sequence CCCATAGCCCTTCAAATGGGCTT CTTTCTCACAACACCCAGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 102} {0: 1, 1: 0, 2: 2, 3: 11, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!