ID: 966047948_966047956

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 966047948 966047956
Species Human (GRCh38) Human (GRCh38)
Location 3:175575866-175575888 3:175575881-175575903
Sequence CCTGGGCTCTACCACCCATTAGG CCATTAGGTAGGACAGTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 112} {0: 1, 1: 0, 2: 1, 3: 14, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!