ID: 966047948_966047959

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 966047948 966047959
Species Human (GRCh38) Human (GRCh38)
Location 3:175575866-175575888 3:175575914-175575936
Sequence CCTGGGCTCTACCACCCATTAGG TGCATTTTTAACAGTCTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 112} {0: 1, 1: 2, 2: 16, 3: 130, 4: 869}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!