ID: 966060769_966060775

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 966060769 966060775
Species Human (GRCh38) Human (GRCh38)
Location 3:175751819-175751841 3:175751852-175751874
Sequence CCGTGCCTTAAGTAAAGTTTTAT GTTTTTATGGGGTTTTTGTAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 39, 4: 406} {0: 1, 1: 0, 2: 0, 3: 59, 4: 736}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!