ID: 966066380_966066383

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 966066380 966066383
Species Human (GRCh38) Human (GRCh38)
Location 3:175826822-175826844 3:175826841-175826863
Sequence CCATTGGAGACAAAGGTTTCTGT CTGTACTGGAGAAAGAAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 284} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!