ID: 966158704_966158715

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 966158704 966158715
Species Human (GRCh38) Human (GRCh38)
Location 3:176945887-176945909 3:176945936-176945958
Sequence CCATGAAGCCAGTCCCTGGTGCC AAGATGAAACAGAATGAGGAAGG
Strand - +
Off-target summary {0: 13, 1: 303, 2: 613, 3: 1167, 4: 1554} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!