ID: 966175078_966175081

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 966175078 966175081
Species Human (GRCh38) Human (GRCh38)
Location 3:177129819-177129841 3:177129847-177129869
Sequence CCATGAAGACAACCTGGCAGTGA AAAAATGCACATATCCAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 184} {0: 1, 1: 0, 2: 6, 3: 49, 4: 531}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!