ID: 966177731_966177734

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 966177731 966177734
Species Human (GRCh38) Human (GRCh38)
Location 3:177157358-177157380 3:177157387-177157409
Sequence CCATTCTTCAGCAGTCATTAGTC CCCTCTCACTACAGATTTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 153} {0: 1, 1: 0, 2: 1, 3: 16, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!