ID: 966297552_966297554

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 966297552 966297554
Species Human (GRCh38) Human (GRCh38)
Location 3:178441428-178441450 3:178441462-178441484
Sequence CCTGCCAAAATCTCTATAAACAG CTATCTGCAGTAAACTATTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 213} {0: 1, 1: 0, 2: 0, 3: 17, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!