ID: 966325066_966325067

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 966325066 966325067
Species Human (GRCh38) Human (GRCh38)
Location 3:178744793-178744815 3:178744813-178744835
Sequence CCTGATTTTGCTCTTCTTACACA ACAAGTTATCAGCCACTTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 299} {0: 1, 1: 0, 2: 1, 3: 7, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!