ID: 966346752_966346755

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 966346752 966346755
Species Human (GRCh38) Human (GRCh38)
Location 3:178989362-178989384 3:178989380-178989402
Sequence CCTTCTTCACAAGGCAGCAGGAA AGGAAAGACAGAGAGAGCAGGGG
Strand - +
Off-target summary {0: 212, 1: 673, 2: 1611, 3: 2101, 4: 2583} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!