|
Left Crispr |
Right Crispr |
| Crispr ID |
966353265 |
966353276 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:179054718-179054740
|
3:179054765-179054787
|
| Sequence |
CCATCCAACACTGCTGCTTGCCG |
CCATGCCTCCGGATCCAGCAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 70, 3: 139, 4: 215} |
{0: 1, 1: 22, 2: 77, 3: 138, 4: 230} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|