ID: 966379189_966379198

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 966379189 966379198
Species Human (GRCh38) Human (GRCh38)
Location 3:179326158-179326180 3:179326210-179326232
Sequence CCGTCTCTACTAAAAATACAAAA AATCCCAGCCTCCTGCTGGCGGG
Strand - +
Off-target summary {0: 194929, 1: 143151, 2: 66814, 3: 37831, 4: 46551} {0: 1, 1: 0, 2: 1, 3: 34, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!