ID: 966427726_966427729

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 966427726 966427729
Species Human (GRCh38) Human (GRCh38)
Location 3:179798328-179798350 3:179798351-179798373
Sequence CCATTTTTCAGGAGTCATGGGGA GTGAGTTTTGGAGGAAGTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 141} {0: 1, 1: 0, 2: 2, 3: 53, 4: 471}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!