ID: 966505173_966505176

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 966505173 966505176
Species Human (GRCh38) Human (GRCh38)
Location 3:180692590-180692612 3:180692641-180692663
Sequence CCTGAGTTTGGCTGGGAGAGTAC TACCAGTAGTTTAACACTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 99} {0: 1, 1: 0, 2: 1, 3: 8, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!