|
Left Crispr |
Right Crispr |
Crispr ID |
966508167 |
966508173 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:180730620-180730642
|
3:180730656-180730678
|
Sequence |
CCACCACGAGAACAGCATGGGAA |
TGATTCAATTACCTCCCACCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 15, 2: 121, 3: 194, 4: 476} |
{0: 1557, 1: 4669, 2: 8676, 3: 9631, 4: 7761} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|