ID: 966533291_966533303

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 966533291 966533303
Species Human (GRCh38) Human (GRCh38)
Location 3:181004330-181004352 3:181004380-181004402
Sequence CCTCAGTAATGACAGACGCCCCT TTGACTTTAGACTGCTATGCTGG
Strand - +
Off-target summary {0: 3, 1: 88, 2: 395, 3: 911, 4: 1427} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!