ID: 966559568_966559569

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 966559568 966559569
Species Human (GRCh38) Human (GRCh38)
Location 3:181304908-181304930 3:181304955-181304977
Sequence CCTTGTAAAAGATGCTCATAGTG TATTAAAATAATTAAATTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 110} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!