ID: 966564428_966564434

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 966564428 966564434
Species Human (GRCh38) Human (GRCh38)
Location 3:181360708-181360730 3:181360761-181360783
Sequence CCATGGCACTCCAGCCTGGGCAA AGAAGAAGAAGAAGAAGGAAGGG
Strand - +
Off-target summary No data {0: 10, 1: 75, 2: 654, 3: 2086, 4: 7677}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!