|
Left Crispr |
Right Crispr |
| Crispr ID |
966564429 |
966564434 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:181360718-181360740
|
3:181360761-181360783
|
| Sequence |
CCAGCCTGGGCAACAAGAGTGAA |
AGAAGAAGAAGAAGAAGGAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 11753, 1: 22317, 2: 29357, 3: 23571, 4: 20346} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|