|
Left Crispr |
Right Crispr |
| Crispr ID |
966564430 |
966564433 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:181360722-181360744
|
3:181360760-181360782
|
| Sequence |
CCTGGGCAACAAGAGTGAAATTC |
AAGAAGAAGAAGAAGAAGGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 615, 1: 12761, 2: 23075, 3: 28876, 4: 22770} |
{0: 10, 1: 198, 2: 474, 3: 1669, 4: 7148} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|