ID: 966592825_966592833

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 966592825 966592833
Species Human (GRCh38) Human (GRCh38)
Location 3:181700538-181700560 3:181700572-181700594
Sequence CCTGAGAGAAGGAATTACAGAGC GGAAGGTGGGAGGGTTTCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 299} {0: 1, 1: 0, 2: 9, 3: 57, 4: 488}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!