ID: 966603846_966603847

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 966603846 966603847
Species Human (GRCh38) Human (GRCh38)
Location 3:181802074-181802096 3:181802090-181802112
Sequence CCTCATTGCTAAAATTGGTTGAT GGTTGATAAATTTACATCTGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!