ID: 966619862_966619868

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 966619862 966619868
Species Human (GRCh38) Human (GRCh38)
Location 3:181952296-181952318 3:181952333-181952355
Sequence CCCAGACAACTAAACTGACATCT TCTGGTGCCCAGGAGCACCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 31, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!