ID: 966637010_966637019

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 966637010 966637019
Species Human (GRCh38) Human (GRCh38)
Location 3:182146644-182146666 3:182146689-182146711
Sequence CCAGATCCTTGTCCCCTTAAGCC AAGACCAACAGGAAACACTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 20, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!