ID: 966691316_966691317

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 966691316 966691317
Species Human (GRCh38) Human (GRCh38)
Location 3:182744488-182744510 3:182744535-182744557
Sequence CCAAATAAATCTATTATGGCTAA AAACATATGACCATACTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 224} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!