ID: 966696338_966696348

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 966696338 966696348
Species Human (GRCh38) Human (GRCh38)
Location 3:182793721-182793743 3:182793736-182793758
Sequence CCCCGCGCCCCGCGGGACCCGGA GACCCGGACGGCGACGACGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 273} {0: 1, 1: 0, 2: 1, 3: 5, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!