ID: 966716915_966716919

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 966716915 966716919
Species Human (GRCh38) Human (GRCh38)
Location 3:183021959-183021981 3:183021972-183021994
Sequence CCATCCACCTTCCTACTGTCCAC TACTGTCCACCTTCCCCACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 492} {0: 1, 1: 0, 2: 2, 3: 9, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!